This digitally enhanced exposure image shows that very low levels of LSU protein accumulation in two silenced plants (S1 silenced)

This digitally enhanced exposure image shows that very low levels of LSU protein accumulation in two silenced plants (S1 silenced). 1471-2229-13-138-S5.pdf (233K) GUID:?EF92018B-F4C5-4333-B6AD-72DAEC9C3E87 Additional file 6: Figure S6 Accumulation of plastid-encoded mRNA and rRNA in lower leaf regions from and mutant plants. insertion-mutant seedlings. Sizes in mm indicate the length of the fist leaf on a mutant herb. Note that each image pair is shown at a different scale. Bottom panels: Wild type Col0 plants growing on MS media supplemented with increased sucrose. A stepwise increases of 3% (left) to 8% (right) sucrose was necessary to initiate and support the growth of the low Rubisco insertion mutants. Note that the lower level of RLSB in the second double mutant (lane 4), relative to the first double mutant (lane 2) corresponds to a lower level of Rubisco LSU in the same mutant, shown in the corresponding LSU lane of Physique?5, panel A. Bottom: Immunoblot of LSU Cloflubicyne Physique?8, panel C, LSU. This digitally enhanced exposure Cloflubicyne image shows that very low levels of LSU protein accumulation in two silenced plants (S1 silenced). This digitally enhanced exposure image shows that very low levels of LSU protein accumulation in two silenced plants (S1 silenced). 1471-2229-13-138-S5.pdf (233K) GUID:?EF92018B-F4C5-4333-B6AD-72DAEC9C3E87 Additional file 6: Figure S6 Accumulation of plastid-encoded mRNA and rRNA in lower leaf regions from and mutant plants. 28S and 18S are cytoplasmic rRNAs. 16S rRNA and the 23S* cleavage product of 23S rRNA are chloroplastic. For Cloflubicyne qRT-PCR shown in A and B, quantification of transcript levels was standardized to actin mRNA. Data is usually averaged for two RLSB/RLSB plants and four siblings, with three repeats run for each of the herb samples. Note differences in scale for panels A and B, due to the much greater abundance of rRNA relative to the mRNAs. Statistical significance was calculated using Students t-test. For each bar, P values were less than 0.05. 1471-2229-13-138-S6.pdf (227K) GUID:?0AC3DE3D-0CBF-4D26-8F23-488115E0DF77 Additional file 7: Figure S7 Low magnification immunolocalization image of RLSB and Rubisco LSU proteins in leaf sections of the C3 herb leaf section reacted with RLSB primary antiserum. B. leaf sections reacted with LSU primary antiserum. C. leaf section showing autofluorescence of plastids (imaged enhanced) from a section reacted with secondary antibody alone. D. DIC image of the images shown in A and C, with chloroplasts indicated. cp, chloroplasts. leaf sections were incubated with the indicated primary antiserum, and then with R-phycoerythrin (A, B) conjugated secondary antibody. Images were captured using a 20X objective of a Leica DMIRE2 inverted fluorescent microscope, bar?=?100?M. 1471-2229-13-138-S7.pdf (884K) GUID:?877F056B-C56D-422D-BB31-69B914A411DC Additional file 8: Physique S8 Rubisco protein and mRNA accumulation in T-DNA insertion heterozygotes, non-mutant siblings, and wild type Col0 locus, and wild type non-insert containing plants reacted with LSU antisera (top panels). Equal amounts of protein were loaded in each lane. As a control, the blot was re-probed with actin antisera (bottom panels). B. Segregating wild type siblings lacking T-DNA inserts showed no LSU reduction. C. qRT-PCR analysis of and (standardization controls). For each bar, P values were less than 0.05. D. Cloflubicyne Genomic PCR analysis of T-DNA insert in At1g71720 locus. Ethidium-bromide stained agarose gel showing representative PCR amplifications using total DNA isolated from the indicated plants. The three primers added to each PCR reaction were: LP (At1g71720 sequence upstream of insert site) = TCGATTGCTGATTTTGATTCC; RP (At1g71720 sequence downstream of insert site) = TTCCTTCCCCTTTTTCATGTC; LBB1 (left border of T-DNA) = GCGTGGACCGCTTGCTGCAACT (Reverse AGTTGCAGCAAGCGGTCCACGC). Sequencing confirmed the identity of the amplified fragments. A 261 nucleotide band corresponding to crazy type At1g71720 was amplified from LP and RP primers if there is no put in; A 128 nt music group was amplified RICTOR from LBB1 and LP if the locus contained an put in. Street 1 = wt Col0 (regular LSU amounts), displaying a music group of 261 nt. Street 2 = heterozygote AT SALK 017226 (decreased LSU), displaying two amplified rings of 261 and 128 nt. Street 3 = AT SALK 017226 segregate (sibling vegetable with regular LSU levels no T-DNA put in), showing an individual amplified music group at 261 nt. 1471-2229-13-138-S8.pdf (287K) GUID:?AD9D6D84-1592-4631-85D3-69A3F118D0B3 Extra file 9 List.