HPA016480)
HPA016480). activity-dependent increases in presynaptic free calcium, suggesting that SV endocytosis may be controlled by calcium accumulation and efflux from mitochondria in their immediate vicinity. Keywords: calcium, endocytosis, mitochondria, neuron, synapse, vesicles == Introduction == Action potential stimulation causes influx of extracellular calcium into central nerve terminals through voltage-gated calcium channels. This increase in [Ca2+]itriggers synaptic vesicle (SV)2exocytosis (1) 3-methoxy Tyramine HCl and modulates the kinetics of SV endocytosis (2). Alterations in the rate of calcium clearance from the nerve terminal both during and after stimulation can result in short-term plastic changes in the efficiency of neurotransmitter release (3) resulting from modified SV exocytosis and/or endocytosis kinetics. Calcium clearance occurs via several routes, including diffusion, extracellular extrusion by the plasma membrane Ca2+ATPase and Na+/Ca2+exchangers, and accumulation into mitochondria (4). Mitochondrial calcium uptake Rabbit Polyclonal to C1R (H chain, Cleaved-Arg463) can modulate neurotransmitter release 3-methoxy Tyramine HCl during intense stimulation in both large atypical central nerve terminals (5) and neuromuscular junctions (68). At typical small central nerve terminals, evidence of an essential role for mitochondrial calcium uptake in the modulation of SV recycling is still absent. Comparisons between nerve terminals with or without 3-methoxy Tyramine HCl mitochondria suggest no difference in the extent and kinetics of SV fusion (911). Furthermore, pharmacological inhibition of mitochondrial calcium uptake has no effect on SV fusion in isolated central nerve terminals (12). Therefore , it is unclear whether mitochondrial calcium uptake plays a direct role in modulating SV recycling during physiological stimulation. Mitochondria accumulate [Ca2+]iinto their matrix via the mitochondrial calcium uniporter (MCU), with uptake driven by the inner mitochondrial membrane potential () (13). Until recently, mitochondrial calcium uptake could only be accessed experimentally by either pharmacological blockers of the MCU or depolarization of, both of which have off-target effects (14). Identification of the gene encoding the MCU channel subunit has allowed direct genetic intervention to determine its role (15, 16). In this study, we manipulated MCU expression in primary neuronal culture to determine whether mitochondrial calcium uptake directly affected SV recycling during physiological stimulation trains. We found that ablating mitochondrial calcium uptake accelerated SV endocytosis with minimal effect on activity-dependent presynaptic [Ca2+]ilevels. == Experimental Procedures == == == == == == Materials == Cell culture media and supplements were obtained from Life Technologies. Papain was from Worthington Biochemical. DL-2-amino-5-phosphonopentanoic acid sodium salt and 6-cyano-7-nitroquinoxaline-2, 3-dione disodium salt were from Abcam. Bafilomycin A1 was from Cayman Chemical. All other reagents were from Sigma-Aldrich. Synaptophysin-pHluorin (syp-pHluorin) was from Prof. L. Lagnado (University of Sussex, UK). Mito-GCaMP2 was from Prof. X. Wang (Yunnan Center for Disease Prevention and Control, China). GCaMP6f (plasmid 40755) and SypHer-mt (plasmid 48251, referred to in this study as mito-pH) were from Addgene. Synaptophysin-mCerulean has been described previously (17). MCU knockdown and overexpression plasmids were from Prof. 3-methoxy Tyramine HCl H. Bading (Interdisciplinary Centre for Neurosciences, Germany). The knockdown plasmids were based on an recombinant adeno-associated virus backbone and contained a calcium/calmodulin-dependent protein kinase II promoter driving mCherry expression and a U6 promoter driving shRNA expression (18). The knockdown plasmids targeted sequences within the 3 UTR of theMcutranscript (shMcu1, TAGGGAATAAAGGGATCTTAA; shMcu2, GGGCTTAGCGAGTCTTGTC; scrambled control, GTGCCAAGACGGGTAGTCA). The MCU plasmid expressed MCU fused to tDimer (18), whereas mCherry was expressed from pmCherryC1 (Clontech). == Cell Culture and Transfection == Primary cultures of dissociated hippocampal neurons were generated from C57Bl/6J mouse embryos of both sexes at embryonic day 17. 5 (17) at a density of 5 104cells/coverslip. After 1011 daysin vitro, cultures were transfected with plasmids using Lipofectamine 2000 (Life Technologies) according to the instructions of the manufacturer and used 2 days after transfection for overexpression and 3 days after transfection for shRNA. == MCU Knockdown and Western Blotting == Primary cortical cultures were infected with an adeno-associated virus containing either shScr or shMcu1 at 1011particles/l. Cells were infected overnight after 4 daysin vitro, and expression was verified by mCherry fluorescence at dayin vitro10. Infection efficiency was estimated to be between 8090%. SDS-PAGE and Western blotting were performed using the Xcell Surelock system (Invitrogen) and precast gradient gels (420%) as described previously (18). Antibody concentrations were as follows: -actin (1: 2000, Abcam, catalog no . ab8227) and Mcu/ccdc109a (1: 500, Sigma, catalog no . HPA016480). Secondary horseradish peroxidase-linked antibodies were used to visualize bands on Kodak.